EST 1176708 is a singleton


Sequence

>1176708 (1 EST) Length=368 ACGATACAACTTTCCTCCCCACACGGTCCATTCGATCTTGCCATCCGTTTGGCGCACATGGGACTCTACCAGCAGGCGAG CGGCATCGTGGACGAGTTGCATCAGCAGCGTGCACTCCGCATGAGTCACTACGGCCTTCTTATTGATGCGCTTTCAGCTC CTTGTTTGGGGCAGCGCATTTTGTACGGCAGCGCACAATGCGACCCCGCTCTAACCTACAAGTTACTTGGAGACGAGAAT GGCGAGGAGCNGGCGCAGGAGGCCCATCGATGGTTTGACATGGCGTTCGCATTGCTGACGACAGAGTGCAGGATGAGTGG GAGTGAGCATCGTTTGCCACAAGCCACGGCGGCCGCAAGCTTATTCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1176708: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767082275644AA532068TENF0355T.cruzi epimastigote normalized cDNA Library


Date: 13:42:22 on Fri 24 Nov 117.