EST 1176710 is a singleton


Sequence

>1176710 (1 EST) Length=405 TCAGATCATCAAAAGTTTTTATGCAACCTCCACCACAGCTAAAGCCTCTGCCAGATTCTTTTCTGGGGCAATTGGAGGAC GATGTTCGCTTGAGTAGCATTCCAAGGGAAGATGTAACTGAGACGTTGGGAAAATTGGGAACATGTGGAAGTGAAATAAA GACTCCGCCGAGAGAAACGGTCGAAAAAGCATCACCTCCACTATCACCCTCAGTGAACGCACAACCACGAATTANANAGA ATCCCCTTCTATACCACCCGTTGCTACTGAAAAGAAAGAGGCGGCATTCTCTATGGATGAGCTTTTTGTCAGCGCACCCG CAGCAGAATCAGGGACCGGGCGGTTCCTTCTGCTCCAGCCGATCCCTTTGGTGGATAACCAGCAATTTTCCGGTGGTTCA TGTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176710: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767102275646AA532070TENF0358T.cruzi epimastigote normalized cDNA Library


Date: 12:14:48 on Mon 20 Nov 117.