EST 1176711 is a singleton


Sequence

>1176711 (1 EST) Length=379 GGCACGATGCACCGTCGCCGTTACCGCCCTACGGAGCGGAATTGTTTCAAGAGGGATGTCCCGTGGCCGCAGTGGCCTCT GTTGTTGCGGCATCACGGCATTCTTCTTTGGCAGCTGAGGAGACCCAATGCCCACCACCGCCGCGGTGTTTTGACTATTA TCTGCGACGAGGTAAGGAGAACGGAAACAGCAGGAAGAGGAGGAGGAGGAATGTCAACGGCGGCTCAATGAAGAGGAGGA AAGACGCCACACTCCACAGGTCTCCTTGTACGCAGAAAGGCGCGGCCCGCGTTCTTTCAATGAATACGTGGAGGCTTCCC GGGAGTGGGAAACGCTGCGGGCGAGCCACATGAAATCAATCGCGGCGAACTTGAGTCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176711: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767112275647AA532071TENF0359T.cruzi epimastigote normalized cDNA Library


Date: 23:4:35 on Wed 22 Nov 117.