EST 1176714 is a singleton


Sequence

>1176714 (1 EST) Length=376 CACAGGGCAATCCCGAATTTCTTCCTCTTCGCGAGTTGGATCCGCAGCTGCACGGGGCTCTTTGTGCACTTAACCGTCAT CACAACCTCCGTCTTCTTCGATATCGGCTACAGCGTGGTATTCATGTCATTCTTTCTCGCCCGATGTCGTTCGTTCTTGA CGAGCTTTTTCGATTGTGTGGCCCGCAGCGGTGCCACCGTCAACGATGCTGGAGGGCCTTGTAAAGTCGATACAGAACTT TGAACACCACTGGCTTGAGCTTCCGAGGCCGGAGGTGATTCTGATCCGCGTGACGGGCGACGCGGCTACGAACGGCGCGG CGAATNCTCGCTGAGATGGACAGCATGCCTTTGGGACGAACGGGAGACACCGGCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1176714: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767142275650AA532074TENF0365T.cruzi epimastigote normalized cDNA Library


Date: 8:22:24 on Thu 23 Nov 117.