EST 1176718 is a singleton


Sequence

>1176718 (1 EST) Length=425 CGCGCGCTGAAGGCAGCACTTGACTTTGCCGTACATGAACGTGATGCCGCCTTGCAGGCCAATCGAGAGGAGGCATTTCT TACCTCTCCGGAAAGAGCCGCCGTGTCAGCACCGCTNGANGAAAGACGAATTTGGATGGACGCACCGCAAACACGTCGAG CGCGACGACCCTCGAGAAGGAAAACACGGAACTGCGCATTGAACTCCGGCGCTCCTTTGAGGATATACGGCAATTGGGAC AAGCCATTGAGCGATCCCATGCAATGTATCAGGAGTTGCAGGAAAATCTGCGGACGGCTGATCGATGTATGCGGGAGAAG GAAAAAACGGCTCGAAGTATGGGGCATCAGCAGGAAATTGCGTTGATGGAGGCAATAGATAGGGAGAGATCGCTGGAAGT TCAACTCCAGCGTCTACGGCAACAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1176718: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767182275654AA532078TENF0372T.cruzi epimastigote normalized cDNA Library


Date: 23:25:4 on Mon 20 Nov 117.