EST 1176719 is a singleton


Sequence

>1176719 (1 EST) Length=174 ACAGGTTCTTGCCATTGTTTTCCCTTGCGGAGGAGACCGGATTTTGATGGCAAAGAGGAGAGGGCTAGAAGACTCGTCAC TCCCACTTTTGTGTTTTTGGGCTCATTCTCACCGCGTCGCACCAACTGCGTGAAGAATCACCTTGGTTTTTACTGTCCTG CGCTCCGCTCCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176719: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767192275655AA532079TENF0374T.cruzi epimastigote normalized cDNA Library


Date: 22:33:25 on Tue 21 Nov 117.