EST 1176721 is a singleton


Sequence

>1176721 (1 EST) Length=332 TGGCGCCGTTCTTCTTGCACTGATTGTGGCCGTTGTTGTCATGTACTTCCGGTTCCGCGCGGCGCAGTGAAGGCCGACGA AGAAATAATTTCCTTGGAGTTGCAACTTCTCAATGCAGGCCATGAAAGGGCAGAATTACCGACGAACAAGCAGGTGAAAG GGCTTTGAATGAGTTAAAGGGGAAATTAAGATTGATAAATGTGAGTGGCGAGCTGAGTAGAGGATATTATTTGGTGACTA AAATGCCCCCTTATATTTTTTAGTGATTTAAGTATAAATATATCAGACCGACCTGCGTCTTGAATTTTCTGTTTACTTAC TTTCTTGTTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176721: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767212275657AA532081TENF0383T.cruzi epimastigote normalized cDNA Library


Date: 22:51:19 on Wed 22 Nov 117.