EST 1176722 is a singleton


Sequence

>1176722 (1 EST) Length=385 AGTGCAGTGAACCGAAGAGGAGGAAAACAAAAAAACAAGCAAAATAAAATAAAAAAAAGAAGAAAAACGTTCTTTTATAT ACTTTTAATGTATTTATATAAAAGAAAATAAATAAAACGAAGAAACAAGGAAAAACGAAAGANAACAAAAAAGAACACAA GTGAGGGGGAAGAAAAAGTCGAAGGAAAAAAGCTTTGAGAAAGTTGTAGGAAACAAACAAACAAAAAACACGAACAAAAA AACAACAACAACAAAACGGACGCTGAGAAGATGTGAGCCGGCAGCGGCGTGAGTGACGTGGCAATGGTGAAGATCTCTCC CTCCCTCCCTCTCTTTCTTNTTTTTTTTTAATTGTTTTGGCGGTGCGTATTTGGCCGCTGCGGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1176722: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767222275658AA532082TENF0384T.cruzi epimastigote normalized cDNA Library


Date: 21:44:42 on Fri 17 Nov 117.