EST 1176726 is a singleton


Sequence

>1176726 (1 EST) Length=341 GGGAGGGCAAAACGTTTACAAAATCAGCAGCGTCTTTCTCCCCCCCCCTCTCGCATTTCTCCCAAACATTTTAGGACGAG GGCGTGAAGAGTAGGGCCGCCGAAAAGAGAGATTTTTACTCATACAGTCATACATACATACATACATACATACATAAATA TATAAATACAGTTATTTTATGAATAATATAAACATTTATTAGAGTTATACGCAACTGCNACCGTAACATTACACATCTGG ATACGCACACTAACTTTCCCCACCTGTGAGGGCGCTTAACTGCTGATGCTGCGTGCCTCACTCATTGTTTATGGCAGCGG ATTTATGCGGACCATTGGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1176726: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767262275662AA532086TENF0394T.cruzi epimastigote normalized cDNA Library


Date: 14:37:7 on Tue 21 Nov 117.