EST 1176727 is a singleton


Sequence

>1176727 (1 EST) Length=273 GGGTTTTCCCCGTTCCTTTTTCTTTTTGTCAGCGATGGACAAAACAAAGACGCTGGAGATGCTCAGTGGCATGAAATTCA TGCAGCGGAAAGAGGAGACAAAACGTCGTCAACGCCTTGAGATGGACCAACAAAAACAGTNGGAGGAGCAACTGCAGGCA AAATCTGGCGCCCGTCATGGCACGAGTGGGATGTCTATTTGGCTCCGGCTCACCCTTCACAAGGAAGAAAAGCNAACCGC AACTAATTCTCTACGACAGCGGGTTTCCCCGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176727: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767272275663AA532087TENF0395T.cruzi epimastigote normalized cDNA Library


Date: 15:34:15 on Fri 24 Nov 117.