EST 1176728 is a singleton


Sequence

>1176728 (1 EST) Length=397 TTGCAGCAGCAACAATGGGACTGCAATGGTACCCACCATCGCGCCGAAAAAAACAAAGCGACGTATATCCTGTAATATAG ACGCTTCTTCCCTTCTTGATCGTGTCCCTCGAGATCCTGGGGCTCATGCAGAGCTCTCAACAGCCGAGCTGGAACGCAAA TTGGAAGAGTGGTCGAATATGAACCCACGGCAACTTCAAGAGCTTTATGATCGCCTAGAGAAGCAGGAAGAGGAGGAGAG CCGCGTACTCACGGAGGACTCATTGTATCAAATGGATGTGTCAATGCGAGACCGCTCTCGAGCCGCTGGTGCGTGTCTTT TGGAAGGATGTGAATGTAGGACCTCTCGATGGGTCACGAGGGGTGGTATACTGTCCTGGTAGATGGACGTAAAGTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1176728: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767282275664AA532088TENF0397T.cruzi epimastigote normalized cDNA Library


Date: 19:33:21 on Mon 20 Nov 117.