EST 1176729 is a singleton


Sequence

>1176729 (1 EST) Length=339 CGTGACCGTGACCGCGGCGTGGATTTAGAACAGATGCCACGGAAAAATAACACAGAGAGGATTATGGTCTGGCATGTGTG TGTGTGTGTGTGTGAAGTCGTCAAATGAGGCTCAATAAAATGTATTTCTGGGGAAGGCAGGGCGAAAAGAAGAAGAAGAA AAAACGTAGGGTTCGTGTCACGGTGATAGTAATGCACCGCGCGCATGTGGGGCCTTTCCCTTTACATTTTGTGTGTTTGT TCTCGCCGCATTAGATGATGCTATTATTCGCCTACTGCCATCCCCATCGTTACTCTTTCTCTCACCGGTGAAAAAAAAAA AAAAAAAAAAAGTTGCGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176729: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767292275665AA532089TENF0402T.cruzi epimastigote normalized cDNA Library


Date: 18:56:46 on Sun 19 Nov 117.