EST 1176746 is a singleton


Sequence

>1176746 (1 EST) Length=413 CAGCAGGCTGGGACGTTGGAGCGAGACCCGNGCGAGATGCTCTTTACAATGCGTAAAAAGCATGAGGACGAGGAGATTGT CATCCGTTGCCTTGGTGAGGAATCGGGCGATGATGATGTCGTTTCACTCGATTTCGATGCATATATTACGTGCAATAACA AGGCGTTGGTGTGCCGAATGAGTTTTGAGAGTGAGGAGGTCATCATGGGGCAGGTCTCCTTCCTGGATGACGCAAAGCTG GCATTAGATGACTCGGTGGAGGGGAACCAGAAGCGCCAGTGGCTGTACAAGGGCCCCAAATTGGACGAACTGGACGAACG CCTCGTTGACTCCCTGACGAGTTACCTCAAAGGACCGGGGTGTGAACGGAGGATTTGTGCAGGTTCAATGGAGGAGTAAC TTCTTCTGGGCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1176746: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767462275682AA532106TENF0460T.cruzi epimastigote normalized cDNA Library


Date: 19:3:5 on Thu 23 Nov 117.