EST 1176747 is a singleton


Sequence

>1176747 (1 EST) Length=410 GGAAAGAAGATCTTGAAGGAAAAAAAAAAGTGTGGGTTTTTTTTGGCGGCGGTGATTGAAGGGAAGGCGGGGTCAAATTG CACGCGGTGGGAGGAATTTAATCGGCGTGGAGCGGCGAGGGGTCATGAGTGTGGCGGATCGACTACGAGCCTTTCGCTAC GCCACTAGTGCCCGTGAGGTCCCGTGGAACCACGTGCGCACGTTNGATGTGGCGGCGCATCGGGTGCAGGAACCGGACCT TTGTCTCATGAAAAATCTTATTTCCCTTCTCTCAGATTGCAACCTTGCCAGTGCGACGTCACCCACAACAAGCTCGGCGG GATGCGTACCAGCTTCTTAGCGCCATGCAACTTGCCCTGCAGTTCCGCCCTTTTGGTCACAGTCGATTCTCAAAGGAGCA GTTTGGTGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176747: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767472275683AA532107TENF0462T.cruzi epimastigote normalized cDNA Library


Date: 15:13:8 on Fri 24 Nov 117.