EST 1176753 is a singleton


Sequence

>1176753 (1 EST) Length=435 GGCACGAGGGTCCGTTTCTGCGTGGTATTTGACGCGGCGCCGCATGATGCTCTTTACTGGGGCGTTTAACACCACTGTGG CCGCCGTGGCTGTCTACGCCTACCCATTTGATCCTACCCTTTCCAACGCGTACGTGTCTATTGCCGCGACTTGTGCCTTC ACGCAATTTATTCTTCATGGCCTTCGCACAAAGGCTTTAATGGCATCCACTCCGCTGGTGGGTGTTTACTATATTTGGTG CCTCTCGCTTCTTGTCTACGGTGTGCAGCGAGGCAGGTGGGCGTACATCCTCCGTGATGACTGATCGCTGCGCAAGGGGG TGGGGAGGATGGCGAAGGAGCCCCTGCGGACTGGGCAATCAGGGGACGAGGAAAGAAGAGCAGCTGAAAGAAGGACAGAG AGAAAGGGGGGATTATCGGCACAGAACCGTGACCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176753: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767532275689AA532157TENF0250T.cruzi epimastigote normalized cDNA Library


Date: 18:10:34 on Fri 17 Nov 117.