EST 1176759 is a singleton


Sequence

>1176759 (1 EST) Length=481 GGCACGATGGTCCTACTTTTCTTGTGACCCACCTGAGCCTGCATGTTGCTCATTGGTCTGACAGGTGGCATTGCGTGTGG GAAGTCCACGGTATCGACGATGCTGGAAAAGCAACATCATCTTACGGTAATTGACGCGGACCGTGTTGTGCGGGAGCTGC AACGCCCTTCAATGCCATGTACACGCAAAATAGCGAGACGGTGGCCGGGGTGCGTAAACTCTCAAACGGGCGAGATTGAC CGTGCCGCTTTGGGCGAAATCATCTTTCGTGATCCGCAGCTCGCCGTGAGCTGGCACGCATCATGAATTTTCCGATTTTT TCTAAAGTTATGCTGTTGTTGGTACGGTTTTGGTGGGAAAGCATGANACAAAGAATGAGGGGTGAGGGACCTCTTCTTGT GGTACTCGATGCACGCTCCTATACGAGTCTAACATCTATACATGGTTTATCGACAGGGTTGTGGTGGTGGATGAAGAGGA G


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1176759: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767592275695AA532163TENF0264T.cruzi epimastigote normalized cDNA Library


Date: 3:55:49 on Sun 19 Nov 117.