EST 1176766 is a singleton


Sequence

>1176766 (1 EST) Length=513 GGCACAGGCGCCGCTGACACCCAGCTGGCTGAACGGCTGTCACAGTCTCATGCACACACTAATTTCCAGGACGGTGCGGA GGTGGAGCGTGATGNCNTCTACTCCAGCCACGCATACGTGCAGGACCTTTACGTTGCCTTCTGTGCCGTTGATGCCTTTT TACGCCATGTTGCAGAGGCGTCGCAATCGACTGCACGAGAGGCGGTCGAAAAAGAGCTGCCGCGTCTTGTAGCTGACCAC ATGCCTATCTGGCAGCTGGCACGCAGTCAATATATGCACGATGCTGTGGAGGACTACCGGCTACTTTTTTTGGACGTGCT GCGATCGTGGACGGTGACGAAACTTCTGCGCCCCGACACGCATCGTCGAATAGAAGAGTACGTGCGGTATAAGCTAAAAA CACTGCGGGACAACTCCACGACTCATGAGGGCGACCAGAAACGTTGGCCGCCGTTCGTCGGANGCAATTAGCGCCGGGGT TGCGTGTGCTGCTTTCTGGCACGGGGGCCGTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176766: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767662275702AA532170TENF0272T.cruzi epimastigote normalized cDNA Library


Date: 19:18:51 on Fri 24 Nov 117.