EST 1176774 is a singleton


Sequence

>1176774 (1 EST) Length=456 GGGTTTGTTTATTCCNGGAGGAGAAAAATGCCTCTTTTATCTTTTGGTTCTCGTGGCCGGAATGAGTCTTCTGCAGATTG CGACACATTCAGTTTACCCCCACCGGACATGGCGGCTGTGAGGGAACTCGTCGAAAAGGCAAAGTTAAGGGCACGTGCAA GCTCGGCGAGGGGAAGAACAAAGAGGGAGAGAAGAAATTTGTTGATCCGAGTCCGTGTGCATTAAAACACTGTATGAATT CCCTGATGAGACGGCTTGGCTGCACATCTACGCGTTTAATGGATTTTGTACAGGCCTTTGTTGTCACCTTCATTACGGTG TACTTTACTGTGGCAGGGTACTCTGGTACCGGGGGCCCGTAAGAAATTCTCAGGGCGTCTTATAGAGTTTGTGGCAAGGG TGTACTGCGTAGACATTTGATTGTCTAGCAGATATTATTATGCATGTAGGTTTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176774: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767742275710AA532178TENF0285T.cruzi epimastigote normalized cDNA Library


Date: 9:27:21 on Sun 19 Nov 117.