EST 1176795 is a singleton


Sequence

>1176795 (1 EST) Length=444 GGCACAGGGTTTCTTTGTGCCGCAACCCCCTAACATCAATAATCAAGGCGGCACATTATGGGGCAATTTGAGTACGGAGC TTTAAACAGTGATAAAACACTGCCACTCTTTTTTGAGATTTCACGCGGAAGAAGAGGGCAATAACTTCATAATGGCAACA TATTTTATACGTTGTTTCTTTTGCATTCCCACTCTGTTGTGAATTTTGATCACATTGTTATCTGCCAGTGGAGGGATACA ATTTTCTCCACAAGTACACGAAAAAAGAAGAACATGGTGTTGTGTGCTGGAGTTTCTTCTGTGCCACTGCCGTCCTGTGG GCTGCCAAAACAAATTGCTATGTGTATTTAGCTTTGTGGAACCGGTAAAGTGCACGGTACTGGNTGAGGGGAAGGCGCGA AGCTACGGCTGCTGCTGCGCCAACGGAATTTATCGCTTCCTGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176795: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767952275731AA532199TENF0333T.cruzi epimastigote normalized cDNA Library


Date: 4:31:56 on Fri 24 Nov 117.