EST 1176797 is a singleton


Sequence

>1176797 (1 EST) Length=370 GGCACGAGGTCTTCACTCCATAGCACCCGCCCACAACAAGGGAAAGAAACGAAAGCGACGTGCGAAACGGTCCGTTTTTG CTGCAACGCTGTCGACGTTCATCCGTTAAAGTTTTGGTTTTGCCAAACGCCCCGTGCAAGTAGAAAACCGGCAAAGTCAG CAACACAAAGGCCAAGAACAAAGAAGGTCCACTTTTCCGACCATGTGCAGGTGATTCTCATTGACCGTGGGAACCAAACC ATGATGTGAATTGTGACGCATACTCTTGCGTATCCAGGGATTTATCATCCGTTGATTGTAACTTATTATTTGGCTGATTT TTGGCGGGTGGGTGGGGCGGCGGCACGTTTTGGAGAGCAATCAAAACCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176797: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767972275733AA532201TENF0337T.cruzi epimastigote normalized cDNA Library


Date: 19:19:8 on Wed 22 Nov 117.