EST 1176798 is a singleton


Sequence

>1176798 (1 EST) Length=432 GGCACGAGGGCGAGGCGGAACGTATGTTTAAGGCGGCGCTCACAATTCAGGAAAAATGTCGCAGATGTCATGCGACTCGC GAGGGTGTTTACGAAGATGGATCAACCCCTCAAAGCACTGGATCTGCTTTCCGAAGCCTCGAANAAAAATCCAATGGATC ACCACCTCCTCCTTCACATGGCACGCCTGTACGATCAGCTGCAAGATGCGGAGAAATCGTGCCAGTTATACCGCCGTGTG TTGCAGTTGGATAGTAGCAACATGGAGTCCATTGCCTGCATTGCGGCGTTATATNTTTTACGAAAAAAAGCAACCGGAGA TTGCGTTTGCGTTTTGTACCGTCCTCTTTTGCAAATGGGCGTTACAGACAACCGACTCTGGAACAATTAGGTCTTGTTGC TCCTACGCTCCCAATACAATTCCCCCCATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1176798: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767982275734AA532202TENF0140T.cruzi epimastigote normalized cDNA Library


Date: 0:48:29 on Fri 24 Nov 117.