EST 1176800 is a singleton


Sequence

>1176800 (1 EST) Length=323 GGCACGAGGGCCGTTCTTTTTACGTGTTTTTGCTGAAAAGTACACCAAGGGGTAATGGACGAGTGACGCCATCCATTTCC AATTCAAAGGATGGTAAGCCATCTCTTCTTAATAGGATGCGGCAGCAGCAGTTTAAGGGGCACCGTGTATGCATTGCCTG GGAGGTTCTCGCTGAACAAGGTCAATGGCGAGATCACGCCAAGGAAGCCCTGGTGGTATTTGCTGTTGATATGGAAGTAT CTGTGATGTGCAGAGTTACTTGCAAACAAGAGAAAAATGAGGTCCTCGCAATGTTGACGGGGATAAGCGGTCTCGTTCGA CAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176800: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768002275736AA532204TENF0146T.cruzi epimastigote normalized cDNA Library


Date: 7:19:14 on Mon 20 Nov 117.