EST 1176809 is a singleton


Sequence

>1176809 (1 EST) Length=304 GGCACGAGGACGTAATCGACTGGAGTCCCATTGGACGCCCACGGTGCCAGGTGCATGTGTTACCCAGCAATCACTACCCA AACTACACGCCGTGGACGCCCAGGAATGGCGACGTCGTACTCGCGCGCACGGTACCAAATGAACCCAACTGGCTCCAGCT CATCAACGGACGTTTCGTGGAACATCAAACATGTGGGGTGCGTCTCGCGATACCCCTTGTGGAGGTGCAAGAGAAAGAGA ACCAGCGGAAGCGAAAGGAGGAGGAGTTACNAAAAATTCTTTAGTGAGAGAAAACCGTGTGTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176809: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768092275745AA532113TENF0162T.cruzi epimastigote normalized cDNA Library


Date: 22:28:18 on Tue 21 Nov 117.