EST 1176814 is a singleton


Sequence

>1176814 (1 EST) Length=342 GGCACGAGGCTGGTCATGTGGTTGAACCACTTTTTTTTTTTTGCCAATATTTTTCAATATTAGCTCTGACTTCCTTCTTC TCCATGTCATTTCCCCATTTTTTCCCTTTTTTTTTTTTTGTTTGTTTGTGTTGTTGTTTTTTTTCCCTTTCTTTTTGTTT GTGTGTGTCTGTAGGGGAGGAGGGGAGAATGTTTGTTTTTCCTGTTTTTGGTTTTTTTTTAAGAGTGCAGTTTTTTCGTT TGTTTGTCTTTTCTTTTCCCTTCCCCCACCCTGCCGTCCTGCCTCTTCCCTTCCCTCCCCTCCGTTCCACCCCGCCCTGC ACGTGGAGGGAAGGGGGCCGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1176814: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768142275750AA532118TENF0173T.cruzi epimastigote normalized cDNA Library


Date: 8:12:30 on Thu 23 Nov 117.