EST 1176815 is a singleton


Sequence

>1176815 (1 EST) Length=373 GGCACGAGGGAAATACGCAAGTGATGCTGCCACGCGTACTTGGGGCAGGCACATTGGAGCTCTTGCGGCAGGATGGCAGC AATGTGACAGCTTCCAAGGCTCTCCAAGGGAAGAAATATCTGCTGGTTTACCTATCCGCCAGTTGGTGTCCTCCGTGTCG ATTTTTCACCCCAAAGCTGGCGGCTTTTTATGAGTCATTTCATAATAGTCACAACTTTGAGATTGTCTTTGTTTCACAAG ATCGTGACAAGCGCTCCATGCAGGCATATTTTCACAACCAAAAGTACAGCAAACTGGCAGTTCGTGGCGGANAGGGTTCA CATGGAGACTGGCTTGCGGTACCGTATGANCAGGCAAAGAAGCTTGGTGTGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1176815: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768152275751AA532119TENF0174T.cruzi epimastigote normalized cDNA Library


Date: 9:17:31 on Sat 18 Nov 117.