EST 1176816 is a singleton


Sequence

>1176816 (1 EST) Length=369 GGCACGAGGGTGCCCTTTTCTTCCATTCGGCTCCTTGTACGTCGGGTGCGGGAGTTATTCGGCACGCTGAAAGGGCGTTA CACGAAGCAGAGGCTAAAGCGACTGCAGGAGCTGACGGCCGATCAGAGTATTCCAGTGCGTGTCTTACCAATGGCGCATC AACTCATCGCCCACACTTACATCGTGGATGGACCTATCACATCCGACTCTGTCGAGTGTTTACNCGAATCGGGTCGAGAG AAGAAAGACGAAGATGAGCAGCTGCGAGAAGAGCAGAGGCGTCTCACAGAGTCGGTTTTTATCCGTAAAAGGGATGCACT TTTCTCCGATGATGGTTTTGCTGCTCGAGTTTGTGGAAGCAACCTCAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176816: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768162275752AA532120TENF0175T.cruzi epimastigote normalized cDNA Library


Date: 11:31:53 on Wed 22 Nov 117.