EST 1176818 is a singleton


Sequence

>1176818 (1 EST) Length=407 GTCACGCTTCTTTTTTCGCGGGATCTGTGCATCTTGGTCAAAGTGTCAAGGGATGTCTGTACGCGCGCAGCTGGACTACG GTGTGCGCTATCTGGACCTGCGCGTGGGGACAAANCCGTAGGACGCCAGCCGACTGTACATATCACACACCCAAATCTCT GTGCCTCTGGCTGATGTGATTGAAGATGTGAAGGCGTTTCTCAATGACCCCTCCTCTGCAAATGAATTTATTGTGCTGGA TTTTCAACACCTATATCTCACGGATGACAGTGACGGGAAGGGTAAGTTTCTTGGGGAGTTGGACCGCCTTTCAGATCGCT TTATACTCGTCAATGTGCCGCTCACAACGCCGNTGGAAATTTTGTGGAAGGTCTCGTCCAGGCGTCNCATCTTTCTAGTG GTGAGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1176818: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768182275754AA532122TENF0179T.cruzi epimastigote normalized cDNA Library


Date: 21:9:57 on Sun 19 Nov 117.