EST 1176819 is a singleton


Sequence

>1176819 (1 EST) Length=285 ACAATTGCAGAACGCCCTTAGATGTGTTCTTGTTTAAAAACGGTTGTTTAGTTCATCAAATTGTAAACTCTCTGCGCCTC GAGCTCGAGCTGCCGCTTGTGTTACGCTACCGCGTGGTGGATTACGTGTGGCAGCAGTGTTACCGTACTGTTCTCCCCGA CGGCGCGGAATTGCCACGTCGTCCTCCCAACGTCGTGTGCACCCCGGAAGAANANGCGCGGGTGGCGCGGGTGGATGCAA ACTTCTCATCAACGTCGCTTCGGCTCATGGACGGTGTGAGCCTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1176819: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768192275755AA532123TENF0181T.cruzi epimastigote normalized cDNA Library


Date: 23:23:58 on Sun 19 Nov 117.