EST 1176822 is a singleton


Sequence

>1176822 (1 EST) Length=420 GGCACGAGGTGCAGTTTCGGACAGCCAAAAATAACCTTGACGATGAGCTGTTTGTTGAATTCCTCAACGAAGTAGTTGTA CGATCGTACTATGGGGCATTTCACTCTCTCGCGCTGCGGGAGGGTAAACGACCACTTCCAGAAACTCATGTGGCGTATCT GCTCCATCTCATGCAAGTTCTTGACCAGGAAATAGAGTTGCTGGGCGGCAACCTACTGCACACGGAGCCCCTCACCTCGC GGCAACGAAGCGGGCGCATACTGACGGCACTTTTGGGGCAATCAAGCCAAGTGCTGGTCCAAATGGCCAAGACGGAGAGG TTGGATAGAACTGAACGCGTGCAAGTTATGCTTCTCTTGCGCTCTCGCACAGACGGGATTGCCAAGCAGTACTTCACAAC CTCTTCTGATAAATGATTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176822: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768222275758AA532126TENF0190T.cruzi epimastigote normalized cDNA Library


Date: 21:43:15 on Mon 20 Nov 117.