EST 1176824 is a singleton


Sequence

>1176824 (1 EST) Length=225 GGCACTAGGAAAATCGCTGATAGAAATGAAATAAAGGAGAAAAGAAATGGGGAAAGAGTAAAAGAATAGAGGCTGCATTC AATGAGCACTGGAATAATTGTGAGGGATCGATGAGATAATATAAAGAGGCATATGTGGGTGGTTGATGAAAATAATCAAT TTGCCATAAAATTTCTTTAAAACACTTTNCTCTCTTNCTCTCTCTTGTGTGTGTGTTTGTGCTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176824: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768242275760AA532128TENF0193T.cruzi epimastigote normalized cDNA Library


Date: 0:57:21 on Wed 22 Nov 117.