EST 1176826 is a singleton


Sequence

>1176826 (1 EST) Length=371 GGCACGAGGGTTGCTTGCTGCTACGATTGTTTGGGCTTCACACAACGAGGGAACAACACGCACGGAGGCATCAGGGATAT TCAAGCTGTANAAAAGACGGAGTCCAACAAGAGAGAACGAGGGAAAAAAGGANAAAATCGGATTAAATAAATGTTTGCTC GTCGGGCACTGCTGGGGAGGACCACGGCGCTCAGGTCCGCGCTGGTGGCACGACACACCGGCTGCGGCAGCAATGAGCAT GCGTTGCGTTGCGGCAGACGGGACTTTGGACAGCTTTTTTTCAAATCTCGCCACGCACTCGCTGCAGGTGCAAGGGTGTG CCTCCCTTAGCACACTCCTTTTACTCCCCGCTGGGCACTGTGATGCTGGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176826: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768262275762AA532130TENF0202T.cruzi epimastigote normalized cDNA Library


Date: 18:27:15 on Fri 17 Nov 117.