EST 1176830 is a singleton


Sequence

>1176830 (1 EST) Length=282 GGCACAGGCTTCGGGACGCCGCACGTGGATTCCGCTCTCCCGCTGGCGGTGGCGCCACCGGAGGCTGTTGTCATGCTACT GATGGATGTGCGACGAAGAGAGCTGCCGAAAACAGGATGGGAGGGCTGCAAGGACATGTTCTTGCTACCCGGCAACAGCA CTCTTATCGTTGATGAAGTAGTTGATGCGGAGGCGTTTACAGAAGAGCTGAGAGTTACGGAAGATGTCACAGTCACCTTT TGAATTTGTGTCTGGGANGGCTGTCACTTGTTCTTCTTCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1176830: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768302275766AA532134TENF0222T.cruzi epimastigote normalized cDNA Library


Date: 21:21:13 on Sun 19 Nov 117.