EST 1176831 is a singleton


Sequence

>1176831 (1 EST) Length=388 GTGAATCCGCCTTTGGGAGATGGTCATTCGTATCACTGTGGGTCCGGAAGTATGAATCTGCGCGCGGCAATGCTACATGT TTTTGGGGATTGTATCCAGGCCTTTGGGGTCGTGGTGGCTGCATCAATCATTTGGTTTGGGAACCTTAAAACGCAAGGTA GCGCTAAGAGTGCAAATAGTTACTACAATTTAGCCGATCCCTTTTTTTCCTTCCTTTTTGGCCTTATCACTATTTACACG ACACGCGACCTTTTCAAGGAAGTAGTTTCTGTGCTCCTCGAGGAAGTCCCCGCTTCCGTGAGCTATGACGGTGTACGGGA TGCGCTTCTGGGTGTAGAAAACGTCGANAAGATTGAATGATTTGCACATGTGGTCGGTTGGGCCGAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1176831: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768312275767AA532135TENF0224T.cruzi epimastigote normalized cDNA Library


Date: 22:7:32 on Sat 18 Nov 117.