EST 1176832 is a singleton


Sequence

>1176832 (1 EST) Length=420 GGCACAGGTATTTTCGGGAGAGAATAAATCTGGCGCTGAGTTGTATGCAAGCACTTCGGACTCTTTCCCATCCCATCTTG AAAACAAAGTTTCTTCTTATCCTGAAGAAGCACGATCGTGTCTTTGATGTTGAGCGGCTCCATAAAAATATTCGCAGTCA GCTTCTTGAACTTGTGACCGAGTTAAACGTGACGGAACATCAAGGAAGCTTTGAGACCTTTGCTACGCACTGCACAGCCC CAAAGGAATTGCTGCCCATGACTGACACACCTGCAATGGATGTATCGGTGCTTCGTCGGTTTGTGGACGGCACACTGTGG GATAGTTTGCCTACTCCAGGCTCTGTCGTGAAGCCCCGTGCCGCTTCCTTTGCCGGTACCCCGTCGACGTTGCCTTCTGC CCCGTTGATCTCCACAAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176832: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768322275768AA532136TENF0226T.cruzi epimastigote normalized cDNA Library


Date: 4:28:3 on Thu 23 Nov 117.