EST 1176834 is a singleton


Sequence

>1176834 (1 EST) Length=399 ACGCNTTCCTTCACAGGACGACACCCCGGCTGCTGCGGCTAGTCCTCCAATGGATGCTTCTCCCGCCCCTGCCTTACAAG ATTNGGAGGGGGAGAAATGTCATGCTGAGGCTTCTGCCCCAGATGAGTCTTTGTTATTCTCCTGTCTGGCGTTTGCATCA CCATCTATTGACGAGAGTNGGATGCGTGGTGCGTACCTGGGCACACGCCGTCCATCTATTAAAATTGCAGATAAGGGGAA AGGATCTACAATTGGTGAAATGCGTCGACAGGCAGAGGCAGCCCAGGCTCGGATGGAAGATATCCGCCTTGTGCAGCTTT TACCCAAGCTATGAGTATTTGAAGTGGGGTCACCGCTACTCGCACACGCGAACGCACACACACACACACACGCGCGCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176834: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768342275770AA532138TENF0228T.cruzi epimastigote normalized cDNA Library


Date: 0:46:49 on Wed 22 Nov 117.