EST 1176835 is a singleton


Sequence

>1176835 (1 EST) Length=317 GCAACTTTTTTTTTTTTTTTTTTCATCTGTTTTTTCACCTTTTTTCACTTTTTTTTTCTTTTTTGCGGACGCCCATGCGT TTGTGTCTTTGTAGTTGAACGCATCCAACGTTGGAATTCACACTCACAGAAGCCAAAACAACAACAACAAAAAACAGGCA CGCACACACACAGAGAGACGGAGAAACTCCTCATATTTCGTTTGTGCCGTCCATCTTCAATGCCTGTAGGTAGGCACATG TACACACACACACACACACACACACAAATCCACGTGGACGGGTGGGACCACTGGAAGGGGGAGAGAAACAAAGCACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1176835: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768352275771AA532139TENF0229T.cruzi epimastigote normalized cDNA Library


Date: 5:13:16 on Tue 21 Nov 117.