EST 1176838 is a singleton


Sequence

>1176838 (1 EST) Length=412 GGCACAGGCTGCGCTGCNAGCCACTACCAAGCCAAACATAACATGGAAATGCCGACGAATTCTACAAGCGCTAGTAGTAC TCGAGCGGCATCTCAAAGCAGCACAAATCTGGGGGCGGCAAATGCCATTTTTGGAGGTGCCACGGATGACGCATAAAGTC TACTACCGGCGTTCACTATGTTCATAGCCAAGAATCTGTTCTTCCACAGGCACCACAGTATCACCTTGATGTTGCACCTA ACGCACCGGAAGAGGGAGATGTGGCAGCTCACTGGCGCTGCGTAAACTACTGCGTTGTGCTGGGCCCTGTGCAGAACATT CAGGAGGGCTACGTATTTGAAGAGAAGGTTGTGCATTTACCGTTAATCACAGACTTTGAAGTCCCTCTTCCGGAGATCCT GATAAGGACTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1176838: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768382275774AA532142TENF0233T.cruzi epimastigote normalized cDNA Library


Date: 20:59:43 on Wed 22 Nov 117.