EST 1176841 is a singleton


Sequence

>1176841 (1 EST) Length=392 CGAACACCTCGTTCCCGGGTCGTCAACGTGCGTGCAACCACTTCTTTTCAGGAGAGTGCAAGTTCGGTGACCGCTGCCGC TATAGTCATGACAAGGAAATTTATGATAGGGAAATGGCGGAAAATGGGCCTCGGCGGCCTAACGATTCTGTTAGCAAGCC GAAAGACTACTCTGAGGTCTGTGAAATTCCTACGCATCGCATCAAGTTCTTACTTGCTAAGAAGGCTGAACGTCTTAAGC AGATTCACATCCAAAATCATACACACAACGAACCATTTAAGCGCGTCGACTCAAACGTTGAGAAGTTTGAGTTGGTAGTG TACGGTCCTGACCCTCAATCTGTTCTGCAGTCAAGAAGATGAATCTTTCATAACGTTGGGTGTGACAAAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1176841: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768412275777AA532145TENF0237T.cruzi epimastigote normalized cDNA Library


Date: 6:27:55 on Thu 23 Nov 117.