EST 1176848 is a singleton


Sequence

>1176848 (1 EST) Length=424 GGCACGAGGTACAACCTCCGCGCGAATGGGGTGGGATCCGGAGGAAACCGGAAAAATTGCGCACAATGTTTACGGGCTAT CGCAGCCCTCCTTCTTTTGTGGATGGGGTGCTGCGGTACATGGGCATCACGAGCGAGGCAGAGTTGATGAGCCAATTGCC TGTATGGAGGCAAGCTGAACTTCATCGTCTTGTGGCGCTGTACGTACGTCTGCGGTTTCCCATTGTTGTTGCGCTCAACA AGTCAGATATACAATCAGTGGCCGGGGAGTTGCATGCTGACCTTCAGCGACGTTATCCTCACGAGAAATTTGTGCCGATG TCTGCAAAGGTGGAGTGTCATCTGCTGCGGCAGAGCGGCCTTGTGGAATACGTCTCTGGGGATTCCTCCTTTCAAGAGAA GGGAAGCAGCGGCGACGGCAGAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1176848: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768482275784AA532152TENF0249T.cruzi epimastigote normalized cDNA Library


Date: 0:10:13 on Sun 19 Nov 117.