EST 1176850 is a singleton


Sequence

>1176850 (1 EST) Length=359 GGCACGAGGCGGCACGAGGGGAATTGACGCATCGGTTTTCCACACCTCTTGGGCCAGCTGCACCTGCTGCGCCGCACACT CCTGATGCTTCCACGCTGGTGATTGAGACGGAGGAGGACAAACAACTGCTTAAACACCAAGCGATAAAAACGAGGTTATC GTCCGTAAGCAAAACGAGGAGAGTTTCCAAAAAAGTAGCAGACAACAACGCACCGCTCTCGGAGGAATTCCAACGGAGAG TACTCTCAAAGGAGCCGATNGCCATGAACGACGACAAGGAACTGTCATCCATGACGTCTGTCTCTTCTCGCTCTCTTGAA GACATGACACCGATNCTCAATCGTTTTGGTCGTCACGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1176850: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768502275786AA532154TENF0057T.cruzi epimastigote normalized cDNA Library


Date: 15:56:51 on Fri 17 Nov 117.