EST 1182602 is a singleton


Sequence

>1182602 (1 EST) Length=330 GGGGAAATGGGTCGAATCAAGCTTAAATGATCAGTATTATATGTTAACCATAGAGTAAAAAAATTCAACATACGAACACA AACATATACATTGAATACAGGCTATAATCTACAGTATCATTTTATCAAAATAACAGTATTGATAAGATAGAGAAGAAGAA GAAGAAGAAGAAGAAGAAGAAGGAAGAGAGATAAGAAGACAATATAACATGGATTGCACAGTTGTATTCCAGTACTTCAA TCATTCATCAATTCATTCATGTAATTCATTGGTCCCTCCTAGCTTTCAACAAATTNNAAAACAAAGGGGNAAAAAATTTT GNCNANATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1182602: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826022196474L46951SCMRAP038C2/C2 adult worm mini-library


Date: 6:42:56 on Sat 25 Nov 117.