EST 1182608 is a singleton


Sequence

>1182608 (1 EST) Length=125 AGGTATATCTCTGTTTCTCTTTGCTCTAGCTTCATTATTCAGGCGATCAAGTCTTTCCTGATCTGTTATGACAAACGCCC CTTCCGCCATCAACAAGGAAAGACGGAGACGCTTCAGGGGTATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1182608: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826082160065L81202SCMRAP0209C2/S1 day seven schistosomula mini-library


Date: 16:16:23 on Mon 20 Nov 117.