EST 1182609 is a singleton


Sequence

>1182609 (1 EST) Length=22 AGGAGTAAGGATCCCTAGGGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1182609: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826092160066L81203SCMRAP0210C2/S1 day seven schistosomula mini-library


Date: 22:51:9 on Wed 22 Nov 117.