EST 1182611 is a singleton


Sequence

>1182611 (1 EST) Length=32 AGGGTATTTTTACACGTAAACTTAGAATCTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1182611: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826112160068L81205SCMRAP0212C2/S1 day seven schistosomula mini-library


Date: 1:12:56 on Mon 20 Nov 117.