EST 1182612 is a singleton


Sequence

>1182612 (1 EST) Length=182 GTAACTTGTNGACCCATTCATTTCGATCTTTGTNGTTTCGTCGACGACGANGTCGTATTTCGTCNCCTACTCCAAATTGA CCTGACCGTATGTTGGAATGTTGTGTTTGAAATGTGTGCGTTTGTGTGTGTGAGTGTGTTTTGTGGTATTTGTTGTTGTT GATGATGGTGTTGTGAGTGGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1182612: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826122160069L81206SCMRAP0305ENR2/ENR2 three hour schistosomula worm


Date: 10:8:3 on Wed 22 Nov 117.