EST 1182618 is a singleton


Sequence

>1182618 (1 EST) Length=491 GTTAGCGGGGCCTGGGACTAACCGATTAGAATAGTTATCGTGTCATTGTGTCATTGGCTTTCGTTCGTTACCGCGGAATC GATTTAGTTCAGGCATAACAATTGGCGACGGGGACAAGAAAAAAAGTGAAAAATGACGCTCCCTTCTGACCGCTTACAGT TGCTATTTGACCGACATTTGGAGTTCATGGTCAAACTACGCTCACAGTTTCTGGATCATCAATGCTTCGCATATGCGTCG GAAGTGGATGTATTAATCCCTGAATTGCACACAGAGCTGGCAAATGATCGCAGCCCCCATGATTCCTCAACAAGCCGCAA CCTGAACGAAACAGCAGTATCACAAGACACGTCCGGTTGTCCATCACCGTCCATTTCAAAAACATGCCCGGTAGTGGATT CAAACCCCACTATCCCTGAATTAGCAGGTCCTAACAATGACGCTTTCAGCTCTCATCAATACGATGCTATGTAAAANCCC ATGAAATGGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1182618: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826182160075L81212SCMRAP0311ENR2/ENR2 three hour schistosomula worm


Date: 15:39:34 on Fri 24 Nov 117.