EST 1182619 is a singleton


Sequence

>1182619 (1 EST) Length=188 GTGTCAAAAACAATATGGACGAAGGTCACTCACCATCCAGAAAACAATGTCTACCATGAGTATCAAANCCATATCACAGA GGGAACTGNTACAGGTTAAACAGGNAAACAGTCAATCTTNTCGTAACCGATGGAGGACGGCCAACAANAGGGCCCCTCTT TGAGGAATACGAGATTCNAAGATAACAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1182619: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826192160076L81213SCMRAP0312ENR2/ENR2 three hour schistosomula worm


Date: 3:49:8 on Sat 18 Nov 117.