EST 1182620 is a singleton


Sequence

>1182620 (1 EST) Length=500 GTCATGGTTTACAATCGCCAGAAGTTCTGCTTTCACAAATATTCAGTAAAGTTAATGGATTCACATATGATTCCAAGTCA TCATTTGTGGAATCATCTTCATCATCATCAACATCATCAAAGTTAAATTCACCTTACGGACGTAGAAGTCTTTCACATTG TAAATTGATCTAATTTTTCTCACTGCACTGAAATTTTCCCGCTATAAAAATTTTTACGGTATCATAGGGTTATACAAGAA GTTTTCTCGTCGAAATGCTATTTCGCCAACTAGAAATATGCTCGTTTACTTCAATTGAACAAGTAAATTGTGTTTAGGAT GGAGCATCTATTTAAAAANTAAAGTCATTGATCAGTTTGTAATCTATTGTGATACAGATAATGTGTTCATCTACACTCTG TTTCGATATGTAACGTATTTTGGAACAGATGGATTGGAAATTGAATATAAAGTATATCTATCTAGTTCTTAGCTACTTCT GCTAATAGTTTTAATAAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1182620: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826202160077L81214SCMRAP0313ENR2/ENR2 three hour schistosomula worm


Date: 4:15:13 on Mon 20 Nov 117.