EST 1182622 is a singleton


Sequence

>1182622 (1 EST) Length=452 GTAATGTGCATGTTGTTGTTAAAGTTAACTGGTGTAAAAGTAGGTCGGAAAAAAACTAGTGTTCAAATCAAAACGTAGCG TTTATCTATGACTCAATAAACTGCTGAACTACGGCCATATTGACAGATGCTAACAACGCAGTGAGGTCTGTAAGATTACC GGGACTAATAAATGGAATGGTTCAGAAATGGTCATAAACACACAGATGTATTTACTCTTTATCTTCTTTTAAATCTTAGT TCTTAAAATAATATTATATTTTTTTAAGGGAAACAATTATTTCTTTTAGAACCATATTTTTCATGTCNAGCTTCTTCTGC TAACACTAATACTGTTACAAATAATGCTAATCTGGCAACTCATTATGTTGATGATGCACATAAGTNCCCAATTTCTTATT ACTCATGACTGACTCAATGAGTACTTAACTATCAATCGTAACTGCTGGGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1182622: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826222160079L81216SCMRAP0315ENR2/ENR2 three hour schistosomula worm


Date: 6:56:15 on Sat 25 Nov 117.