EST 1182623 is a singleton


Sequence

>1182623 (1 EST) Length=355 GTGAGAGGAAATTCATTAACATTAATATTAATGGACATTTTTTTAGATTGCAAATAGATACCGCATCAGACGTCACCATC CTCTCTCACAAAAATTGGATCAAAATGGGTAGCCCAAGCCTGCAGCGAACAACTAAAAAGCCTCGTACCGCATGTGGTAA TTTCCTACACTTAGAAGGACAATTGGAATGTAGAGTGACCTTCCGGGAGTCGTCATTTACCGGGGTATGTCATATAACTC CAGCTGATCTAAATTTACTTGGTTTAGATTGGTTCGATCAACTGAAATTGGCTGATGTCCCACTAAATACCATATGCCAC ATGATATCACAACCTCATGGCACTGAATCGTATAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1182623: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826232160080L81217SCMRAP0316ENR2/ENR2 three hour schistosomula worm


Date: 8:37:53 on Fri 24 Nov 117.